SubtiBank SubtiBank
dps
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dps

iron storage protein, general stress protein, resistance against ethanol and paraquat stresses stress and survival at low temperatures
locus
BSU30650
pI
4.44
mw
16.45 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
function
iron storage, survival of of stress conditions
product
mini-ferritin
essential
no
synonyms
ytkB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,136,238 3,136,675

    The protein

    Protein family

  • dps family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|MrgA]
  • Structure

  • [PDB|1JIG] (from B. anthracis, 63% identity) [pubmed|11836250]
  • Expression and Regulation

    Operons

    genes
    [gene|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps]
    description
    [Pubmed|9393687]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|9393687,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|9393687,15805528]
  • view in new tab

    genes
    [gene|631CD7AD2059BD9A2F56BD7F169B245589465184|ytkA]-[gene|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A296 (ytkB/dps::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/296 NBRP B. subtilis, Japan]
  • BKE30650 ([gene|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTATCTCCTCCTTGTT, downstream forward: _UP4_TAAGTTCAAAAATAGAACGG
  • BKK30650 ([gene|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTATCTCCTCCTTGTT, downstream forward: _UP4_TAAGTTCAAAAATAGAACGG
  • References

    Reviews

  • 15222465
  • Original publications

  • 9393687,9013563,15805528,22582280,11836250