SubtiBank SubtiBank
dps
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dps

iron storage protein, general stress protein, resistance against ethanol and paraquat stresses stress and survival at low temperatures
locus
BSU_30650
pI
4.44
mw
16.45 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
function
iron storage, survival of of stress conditions
product
mini-ferritin
essential
no
synonyms
ytkB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,136,238 3,136,675

    The protein

    Protein family

  • dps family (with [protein|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|MrgA], according to UniProt)
  • Paralogous protein(s)

  • [protein|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|MrgA]
  • Structure

  • [PDB|1JIG] (from B. anthracis, 63% identity) [pubmed|11836250]
  • Expression and Regulation

    Operons

    genes
    [gene|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps]
    description
    [Pubmed|9393687]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|9393687,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|9393687,15805528]
  • view in new tab

    genes
    [gene|631CD7AD2059BD9A2F56BD7F169B245589465184|ytkA]-[gene|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A296 (ytkB/dps::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/296 NBRP B. subtilis, Japan]
  • BKE30650 ([gene|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTATCTCCTCCTTGTT, downstream forward: _UP4_TAAGTTCAAAAATAGAACGG
  • BKK30650 ([gene|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTATCTCCTCCTTGTT, downstream forward: _UP4_TAAGTTCAAAAATAGAACGG
  • References

    Reviews

  • 15222465
  • Original publications

  • 9393687,9013563,15805528,22582280,11836250