SubtiBank SubtiBank
patB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

patB

cystathione-beta-lyase
locus
BSU_31440
pI
5.44
mw
42.63 kDa
protein length
387 aa Sequence Blast
gene length
1164 bp Sequence Blast
function
biosynthesis of methionine
product
cystathione-beta-lyase
essential
no
ec
4.4.1.8
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    Coordinates
    3,228,778 3,229,941

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L,L-cystathionine --> L-homocysteine + NH4+ + pyruvate (according to UniProt)
  • Protein family

  • [SW|class-II pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3T32] (from ''B. anthracis'', 46% identity, 75% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|11B54D438CDD2EAA4A87A6B99851A3B123EA4A1F|patB]
    description
    [Pubmed|9274030]
    view in new tab

    Biological materials

    Mutant

  • 1A952 ( ''patB''::''cat''), [Pubmed|15760717], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A952&Search=1A952 BGSC]
  • BKE31440 ([gene|11B54D438CDD2EAA4A87A6B99851A3B123EA4A1F|patB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTTACCCCCTCATG, downstream forward: _UP4_TAAATATAGCTGTAAACGCC
  • BKK31440 ([gene|11B54D438CDD2EAA4A87A6B99851A3B123EA4A1F|patB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTTACCCCCTCATG, downstream forward: _UP4_TAAATATAGCTGTAAACGCC
  • References

  • 9274030,15760717