SubtiBank SubtiBank
lytH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lytH

differentiation-associated peptidoglycan hydrolase involved in endospore cortex maturation
locus
BSU_32340
pI
6.89
mw
39.48 kDa
protein length
326 aa Sequence Blast
gene length
981 bp Sequence Blast
function
endospore cortex maturation
product
peptidoglycan hydrolase
essential
no
synonyms
yunA,yutA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.4|Endopeptidases]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,321,455 3,322,435

    The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between L-Ala (position 1 in the peptioglycan peptide) and D-Glu (position 2) [Pubmed|18266855]
  • Protein family

  • peptidase M23B family (single member, according to UniProt)
  • Structure

  • [PDB|3NYY] (from Ruminococcus gnavus, the C-terminal peptidase M23 domain, aa 178 ... 315, 46% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|11AF08158121DEDFDDC0F64C52EFF3CF3AE30CE6|lytH]
    description
    [Pubmed|12813075]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|12813075], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|12813075]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B579 (yunA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1578 NBRP B. subtilis, Japan]
  • BKE32340 ([gene|11AF08158121DEDFDDC0F64C52EFF3CF3AE30CE6|lytH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAATAATCTCCTTTCA, downstream forward: _UP4_TAACAAAAAGCCGCCTCTTC
  • BKK32340 ([gene|11AF08158121DEDFDDC0F64C52EFF3CF3AE30CE6|lytH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAATAATCTCCTTTCA, downstream forward: _UP4_TAACAAAAAGCCGCCTCTTC
  • References

    Reviews

  • 18266855
  • Original publications

  • 12813075