SubtiBank SubtiBank
ymfD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ymfD

exporter for the siderophore bacillibactin
locus
BSU_16825
pI
8.36
mw
44.00 kDa
protein length
402 aa Sequence Blast
gene length
1209 bp Sequence Blast
function
iron acquisition
product
bacillibactin exporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.10|Siderophore exporters]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,755,649 1,756,857

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|11997FE6BA6947E7C7E3DBE20B49C9FB758262B2|ymfD]-[gene|43BADA6A6C8248270A50EB3D81253ECE6C84F03F|ymfF]-[gene|9A5EB7CA38D948007AD788297128035AB4074490|ymfH]
    description
    [Pubmed|18502870]

    regulatory mechanism

  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|18502870], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B116 (ymfD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1115 NBRP B. subtilis, Japan]
  • BKE16825 ([gene|11997FE6BA6947E7C7E3DBE20B49C9FB758262B2|ymfD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16825 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCATTTTTCTCTCTCA, downstream forward: _UP4_TAGCCAGCCGTCTTTTTTTG
  • BKK16825 ([gene|11997FE6BA6947E7C7E3DBE20B49C9FB758262B2|ymfD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16825 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCATTTTTCTCTCTCA, downstream forward: _UP4_TAGCCAGCCGTCTTTTTTTG
  • References

  • 18502870