SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


exporter for the siderophore bacillibactin
44.00 kDa
protein length
402 aa Sequence Blast
gene length
1209 bp Sequence Blast
iron acquisition
bacillibactin exporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Siderophore exporters]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|Acquisition of iron / Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,755,649 1,756,857

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|18502870], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • view in new tab

    Biological materials


  • MGNA-B116 (ymfD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16825 ([gene|11997FE6BA6947E7C7E3DBE20B49C9FB758262B2|ymfD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCATTTTTCTCTCTCA, downstream forward: _UP4_TAGCCAGCCGTCTTTTTTTG
  • BKK16825 ([gene|11997FE6BA6947E7C7E3DBE20B49C9FB758262B2|ymfD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCATTTTTCTCTCTCA, downstream forward: _UP4_TAGCCAGCCGTCTTTTTTTG
  • References

  • 18502870