SubtiBank SubtiBank
cgeE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cgeE

maturation of the outermost layer of the spore
locus
BSU_19750
pI
6.27
mw
29.41 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
function
maturation of the outermost layer of the spore
product
unknown
essential
no
synonyms
cgeBC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    2,146,013 2,146,792

    The protein

    [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 110-259) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6C7778EFFADDF522E2DBC32219D83E7CBCF2BED0|cgeC]-[gene|9EDE093896E8535962903D7A202D69C1BC402C09|cgeD]-[gene|11966AE70567D707D546C4A2F12B2DEAE95A1883|cgeE]
    description
    [Pubmed|7592393]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|7592393,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7592393], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|7592393]
  • view in new tab

    Biological materials

    Mutant

  • 1A636 ( ''cgeE''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A636&Search=1A636 BGSC]
  • BKE19750 ([gene|11966AE70567D707D546C4A2F12B2DEAE95A1883|cgeE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACGTCTCCTTTTTAT, downstream forward: _UP4_TGAAATAGGCGTTTGCACAA
  • BKK19750 ([gene|11966AE70567D707D546C4A2F12B2DEAE95A1883|cgeE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACGTCTCCTTTTTAT, downstream forward: _UP4_TGAAATAGGCGTTTGCACAA
  • References

  • 7592393,15699190,26577401