SubtiBank SubtiBank
bshC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bshC

cysteine-adding enzyme required for the synthesis of bacillithiol
locus
BSU15120
pI
5.25
mw
62.44 kDa
protein length
539 aa Sequence Blast
gene length
1620 bp Sequence Blast
function
biosynthesis of bacillithiol
product
cysteine-adding enzyme
essential
no
synonyms
yllA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.2|Biosynthesis of bacillithiol]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,578,376 1,579,995

    Phenotypes of a mutant

  • impaired growth in minimal medium, reduced activity of enzymes containing FeS cluster [Pubmed|25988368]
  • sensitivity to superoxide (paraquate) stress [Pubmed|25988368]
  • The protein

    Structure

  • [PDB|4WBD] [Pubmed|25496067]
  • Expression and Regulation

    Operons

    genes
    [gene|0F153803781C9AC8321FB14F926B645C45E53B00|ylbQ]-[gene|115FA333FAD17ACE5EBF288F16F33C330C6B4473|bshC]
    description
    [Pubmed|20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • ''[protein|search|ylbQ]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B128 (bshC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1127 NBRP B. subtilis, Japan]
  • a ''bshC'' null mutant is available in [SW|John Helmann]s lab
  • BKE15120 ([gene|115FA333FAD17ACE5EBF288F16F33C330C6B4473|bshC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTAGAACTTCCTTT, downstream forward: _UP4_TGAAATAAAGTTTTAAAGAA
  • BKK15120 ([gene|115FA333FAD17ACE5EBF288F16F33C330C6B4473|bshC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTAGAACTTCCTTT, downstream forward: _UP4_TGAAATAAAGTTTTAAAGAA
  • BP953 ([gene|115FA333FAD17ACE5EBF288F16F33C330C6B4473|bshC]::cat ([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::tet), available in [SW|Fabian Commichau]'s lab, [Pubmed|29027347]
  • References

    Reviews

  • 28117687
  • Original Publications

  • 25496067,8636036,20308541,19578333,23894131,25988368,29027347