SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cysteine-adding enzyme required for the synthesis of bacillithiol
62.44 kDa
protein length
539 aa Sequence Blast
gene length
1620 bp Sequence Blast
biosynthesis of bacillithiol
cysteine-adding enzyme

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of bacillithiol]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    1,578,376 1,579,995

    Phenotypes of a mutant

  • impaired growth in minimal medium, reduced activity of enzymes containing FeS cluster [Pubmed|25988368]
  • sensitivity to superoxide (paraquate) stress [Pubmed|25988368]
  • The protein

    Protein family

  • BshC family (single member, according to UniProt)
  • Structure

  • [PDB|4WBD] [Pubmed|25496067]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • ''[protein|search|ylbQ]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials


  • MGNA-B128 (bshC::erm), available at the [ NBRP B. subtilis, Japan]
  • a ''bshC'' null mutant is available in [SW|John Helmann]s lab
  • BKE15120 ([gene|115FA333FAD17ACE5EBF288F16F33C330C6B4473|bshC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTAGAACTTCCTTT, downstream forward: _UP4_TGAAATAAAGTTTTAAAGAA
  • BKK15120 ([gene|115FA333FAD17ACE5EBF288F16F33C330C6B4473|bshC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTAGAACTTCCTTT, downstream forward: _UP4_TGAAATAAAGTTTTAAAGAA
  • BP953 ([gene|115FA333FAD17ACE5EBF288F16F33C330C6B4473|bshC]::cat ([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::tet), available in [SW|Fabian Commichau]'s lab, [Pubmed|29027347]
  • References


  • 28117687
  • Original Publications

  • 25496067,8636036,20308541,19578333,23894131,25988368,29027347