SubtiBank SubtiBank
hom
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hom

homoserine dehydrogenase (NADPH)
locus
BSU32260
pI
4.90
mw
47.33 kDa
protein length
433 aa Sequence Blast
gene length
1302 bp Sequence Blast
function
biosynthesis of methionine and threonine
product
homoserine dehydrogenase (NADPH)
essential
no
ec
1.1.1.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • Gene

    Coordinates
    3,314,828 3,316,129

    The protein

    Catalyzed reaction/ biological activity

  • L-aspartate 4-semialdehyde + NADPH+H+ --> L-homoserine + NADP+ [pubmed|6786715]
  • Protein family

  • Homoserine dehydrogenase family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|ACT domain] (aa 350 ... 426) (according to the Interpro database)
  • [SW|Cofactors]

  • NADPH [pubmed|6786715]
  • Structure

  • [PDB|2EJW] (from ''Thermus thermophilus hb8'', 37% identity, 57% similarity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|yutH]-[gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    genes
    [gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24163341], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR]: repression, [Pubmed|27260660], in [regulon|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR regulon]
  • regulation

  • expressed in the presence of lysine or cysteine ([SW|ThrR]) [Pubmed|27260660]
  • view in new tab

    Biological materials

    Mutant

  • BKE32260 ([gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAACTCCACCTTTCT, downstream forward: _UP4_GTAGAAGGGAACGGTTGGAG
  • BKK32260 ([gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAACTCCACCTTTCT, downstream forward: _UP4_GTAGAAGGGAACGGTTGGAG
  • Expression vector

  • pGP2297 (expression with SUMO protein and N-terminal His-tag from ''E. coli'', in [SW|pET-SUMOadapt]), available in [SW|Jörg Stülke]'s lab
  • pGP2300 (expression with N-terminal His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pBP312 (in [SW|pAC5]), available in [SW|Fabian Commichau]'s lab [Pubmed|27260660]
  • References

  • 12107147,18763711,3139660,19258532,24163341,25777134,15378759,25755103,27260660,6786715