SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]-dependent [SW|sporulation] gene
8.30 kDa
protein length
gene length
213 bp Sequence Blast
[category|SW 4.2|Sporulation]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,070,111 1,070,323

    Phenotypes of a mutant

  • defect in sporulation [Pubmed|14523133]
  • The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials


  • BKE09940 ([gene|1136EF75DD3302539EC94DE061B88C6DBCE5AF4C|yhaL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGGCTCCTCCCCCTTTG, downstream forward: _UP4_TAAAAAAAGCTGTGCGGCTC
  • BKK09940 ([gene|1136EF75DD3302539EC94DE061B88C6DBCE5AF4C|yhaL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGGCTCCTCCCCCTTTG, downstream forward: _UP4_TAAAAAAAGCTGTGCGGCTC
  • References

  • 14523133