SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


52.38 kDa
protein length
469 aa Sequence Blast
gene length
1410 bp Sequence Blast
arabinan degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of arabinan/ arabinose/ arabitol]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    4,039,466 4,040,875

    The protein

    Catalyzed reaction/ biological activity

  • Endohydrolysis of (1->5)-alpha-arabinofuranosidic linkages in (1->5)-arabinans (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 43 family] (according to UniProt)
  • Kinetic information

  • With linear-alpha-1,5-l-arabinan as the preferred substrate, the enzyme exhibited an apparent K(m) of 2.0 mg ml(-1) and V(max) of 0.25 mmol min(-1) mg(-1) at pH 7.0 and 50C. [Pubmed|18408032]
  • [SW|Domains]

  • N-terminal catalytic domain with a characteristic -propeller fold and a C-terminal domain whose function is unknown [Pubmed|24549757]
  • [SW|Cofactors]

  • Ca2+ [Pubmed|24549757]
  • Structure

  • [PDB|2X8F] [Pubmed|20883454]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862,18408032]
  • Expression and Regulation



    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|18408032], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, unknown [Pubmed|18408032], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression is stimulated by arabinose and pectin and repressed by glucose [Pubmed|18408032]
  • view in new tab

    Biological materials


  • MGNA-B716 (yxiA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39330 ([gene|1130F1D4CBDDF7B8FFCAF929B8BC4D283233679A|abn2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAACAATTCGCCTCT, downstream forward: _UP4_TAAGATGGAGAAGCGCCTTC
  • BKK39330 ([gene|1130F1D4CBDDF7B8FFCAF929B8BC4D283233679A|abn2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAACAATTCGCCTCT, downstream forward: _UP4_TAAGATGGAGAAGCGCCTTC
  • labs

  • [ [Isabel de Sa-Nogueira]], Lisboa, Portugal [homepage]
  • References

  • 18607095,24549757,18408032,18957862,12850135,18408032,20883454