SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[SW|sigma factor ]of the [SW|RNA polymerase], Sigma-54, Sigma L
49.54 kDa
protein length
436 aa Sequence Blast
gene length
1311 bp Sequence Blast
utilization of arginin, acetoin and fructose, required for cold adaptation
[SW|RNA polymerase] sigma-54 factor (sigma-L)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • Gene

    3,512,498 3,513,808

    Phenotypes of a mutant

  • The mutant is cold-sensitive and unable to use arginine as a single carbon source [pubmed|16585774]
  • The protein

    Catalyzed reaction/ biological activity

  • Binding to promoters of the -12, -24 type
  • Protein family

  • sigma-54 factor family (single member, according to UniProt)
  • [SW|Domains]

  • DNA binding domain (HTH motif) (324343)
  • pron box domain (413421)
  • 3 x Compositional bias domain (621),(3253),(112136)
  • Structure

  • [PDB|5BYH] (''E. coli'' [SW|RNA polymerase] containing Sigma-54) [Pubmed|26293966]
  • Additional information

  • Transcription initiation by SigL-containing [SW|RNA polymerase] requires the activity of ATP-hydrolyzing transcription activators
  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, transcriptional roadblock [Pubmed|16166551], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|16166551]
  • view in new tab

    Biological materials


  • GP146 (Δ''sigL''::spc), available in [SW|Jörg Stülke]'s lab [Pubmed|17183217]
  • GP2302 (Δ''sigL''::tet), available in [SW|Jörg Stülke]'s lab
  • 1A914 (''sigL''::''kan''), [Pubmed|16585774], available at [ BGSC]
  • BKE34200 (Δ[gene|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGCTCACTCCCCTTT, downstream forward: _UP4_TAAAATCCTCCCTAGACGGG
  • BKK34200 (Δ[gene|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGCTCACTCCCCTTT, downstream forward: _UP4_TAAAATCCTCCCTAGACGGG
  • labs

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [ Homepage]
  • References


  • 7934866,10894718,21054445,26010401,21906631
  • Original publications

  • 16585774,11274109,1924373,16166551,22900538,26293966,24553251