SubtiBank SubtiBank
sasA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sasA

(p)ppGpp synthetase, small alarmone synthetase
locus
BSU_38480
pI
6.22
mw
24.45 kDa
protein length
210 aa Sequence Blast
gene length
633 bp Sequence Blast
function
ppGpp synthesis independent from stringent response
product
(p)ppGpp synthetase
essential
no
synonyms
ywaC,relP,ipa-7d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,949,952 3,950,584

    Phenotypes of a mutant

  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24163341]
  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant acquires suppressor mutations in ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24682323,24163341]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)
  • Protein family

  • RelA/SpoT family (with [protein|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|SasB] and [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA], according to UniProt)
  • Paralogous protein(s)

  • [protein|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|SasB]
  • [SW|Domains]

  • single ppGpp synthetase domain [Pubmed|24163341]
  • Structure

  • [PDB|6FGK] [Pubmed|29391580]
  • Expression and Regulation

    Operons

    genes
    [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]
    description
    [Pubmed|11866510]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421,11866510,18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B218 (ywaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1217 NBRP B. subtilis, Japan]
  • GP2066 (''[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]::mls''), available in [SW|Jörg Stülke]'s lab
  • BKE38480 ([gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA, downstream forward: _UP4_TAAAAAAGACGGCACCCAAG
  • BKK38480 ([gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA, downstream forward: _UP4_TAAAAAAGACGGCACCCAAG
  • References

    Reviews

  • 27149325,,30980074
  • Original publications

  • 29391580,21926231,22950019,18670626,19447912,18067544,19477419,12207695,11866510,18179421,24163341,24489751,24687489,24682323,26460002,27875634