SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


(p)ppGpp synthetase, small alarmone synthetase
24.45 kDa
protein length
210 aa Sequence Blast
gene length
633 bp Sequence Blast
ppGpp synthesis independent from stringent response
(p)ppGpp synthetase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    3,949,952 3,950,584

    Phenotypes of a mutant

  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24163341]
  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant acquires suppressor mutations in ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24682323,24163341]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)
  • Protein family

  • RelA/SpoT family (with [protein|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|SasB] and [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA], according to UniProt)
  • Paralogous protein(s)

  • [protein|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|SasB]
  • [SW|Domains]

  • single ppGpp synthetase domain [Pubmed|24163341]
  • Structure

  • [PDB|6FGK] [Pubmed|29391580]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421,11866510,18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: repression, [pubmed|31723135], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] mutant [Pubmed|21926231]
  • exhibits high levels of extrinsic noise in expression (mediated via [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC]-dependent phosphorylation of [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR] on Thr-101) [pubmed|31723135]
  • view in new tab

    Biological materials


  • MGNA-B218 (ywaC::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2066 (''[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]::mls''), available in [SW|Jörg Stülke]'s lab
  • BKE38480 ([gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA, downstream forward: _UP4_TAAAAAAGACGGCACCCAAG
  • BKK38480 ([gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA, downstream forward: _UP4_TAAAAAAGACGGCACCCAAG
  • References


  • 27149325,,30980074
  • Original publications

  • 29391580,21926231,22950019,18670626,19447912,18067544,19477419,12207695,11866510,18179421,24163341,24489751,24687489,24682323,26460002,27875634,31723135