SubtiBank SubtiBank
dctP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

dctP

uptake of succinate, fumurate, malate and oxaloacetate via proton symport
locus
BSU_04470
pI
8.67
mw
45.28 kDa
protein length
421 aa Sequence Blast
gene length
1266 bp Sequence Blast
function
uptake of succinate, fumurate, malate and oxaloacetate
product
C4-dicarboxylate transport protein
essential
no
synonyms
ydbH,dctA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.6|Dicarboxylate/amino acid:cation symporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    500,166 501,431

    The protein

    Catalyzed reaction/ biological activity

  • uptake of succinate, fumurate, malate and oxaloacetate via proton symport [Pubmed|20363944]
  • acts as co-sensor for [protein|9A96572B101358768EB20EE9438BE0E1424A4130|DctS] [Pubmed|24375102]
  • Protein family

  • [SW|dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|GltT], [protein|622856EE642C42247C658DBD57E6A18C6E81FE58|GltP]
  • Structure

  • [PDB|4KY0] (the glutamate transporter of ''Thermococcus kodakarensis'', 31% identity, 71% similarity) [Pubmed|24013209]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]
    description
    [Pubmed|10708364]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10708364], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: indirect effect, in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • part of the iron sparing response, strong down-regulation in a'' [protein|search|fur]'' mutant ([protein|search|Fur], [protein|search|FsrA]) [Pubmed|22389480]
  • view in new tab

    genes
    [gene|9A96572B101358768EB20EE9438BE0E1424A4130|dctS]-[gene|97C34F6FA0B89D93369150E9A8AB3579332B07BC|dctR]-[gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]
    description
    [Pubmed|10708364]

    regulation

  • part of the iron sparing response, strong down-regulation in a'' [protein|search|fur]'' mutant ([protein|search|Fur], [protein|search|FsrA]) [Pubmed|22389480]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation inhibition, [Pubmed|22389480]
  • Biological materials

    Mutant

  • BKE04470 ([gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCTTCATCCCCCTGT, downstream forward: _UP4_TGAAAAAAGAACGGCCCATC
  • BKK04470 ([gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCTTCATCCCCCTGT, downstream forward: _UP4_TGAAAAAAGAACGGCCCATC
  • GP2600 ([gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 12850135,10708364,10627041,12949159,20363944,22389480,22900538,24013209,24375102