SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


15.59 kDa
protein length
137 aa Sequence Blast
gene length
414 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,235,806 3,236,219

    The protein

    Protein family

  • DCC thiol-disulfide oxidoreductase family (single member, according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7961491], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • the terminator is [protein|search|NusA]-dependent [ Reference]
  • view in new tab

    Biological materials


  • MGNA-B552 (yuxK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31500 ([gene|1069B74CDD87706FA00A495AEA04BB89D79EDF21|yuxK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCATATCCCCTCCGAT, downstream forward: _UP4_TAAATAAAAAATGGCTAGGA
  • BKK31500 ([gene|1069B74CDD87706FA00A495AEA04BB89D79EDF21|yuxK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCATATCCCCTCCGAT, downstream forward: _UP4_TAAATAAAAAATGGCTAGGA
  • References

  • 7961491