SubtiBank SubtiBank
yuxK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuxK

unknown
locus
BSU_31500
pI
10.26
mw
15.59 kDa
protein length
137 aa Sequence Blast
gene length
414 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yugD

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,235,806 3,236,219

    The protein

    Protein family

  • DCC thiol-disulfide oxidoreductase family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E50D4B30C2A0987A356C988AF8A4951C0CDF6C06|pbpD]-[gene|1069B74CDD87706FA00A495AEA04BB89D79EDF21|yuxK]
    description
    [Pubmed|7961491]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7961491], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • the terminator is [protein|search|NusA]-dependent [ http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B552 (yuxK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1551 NBRP B. subtilis, Japan]
  • BKE31500 ([gene|1069B74CDD87706FA00A495AEA04BB89D79EDF21|yuxK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCATATCCCCTCCGAT, downstream forward: _UP4_TAAATAAAAAATGGCTAGGA
  • BKK31500 ([gene|1069B74CDD87706FA00A495AEA04BB89D79EDF21|yuxK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCATATCCCCTCCGAT, downstream forward: _UP4_TAAATAAAAAATGGCTAGGA
  • References

  • 7961491