SubtiBank SubtiBank
yteU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yteU

unknown
locus
BSU_30090
pI
9.85
mw
25.79 kDa
protein length
222 aa Sequence Blast
gene length
669 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,078,643 3,079,311

    Expression and Regulation

    Operons

    genes
    [gene|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]-[gene|40787292458E5C6676F9F4F6F34C0D6BD5313DE1|yteR]-[gene|1482FD92CB6DC966263F08AD109769728FC708E4|yteS]-[gene|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT]-[gene|103A912E971E5760DBA45CC0681D77CED61D1FED|yteU]-[gene|FCAE9513D764B7A9AAB9C59E6CE1D65C400D4B44|yteV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A814 (yteU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/814 NBRP B. subtilis, Japan]
  • BKE30090 ([gene|103A912E971E5760DBA45CC0681D77CED61D1FED|yteU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGCCCCCTCCTTTTT, downstream forward: _UP4_TAATCATCATTTCTCTATCA
  • BKK30090 ([gene|103A912E971E5760DBA45CC0681D77CED61D1FED|yteU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGCCCCCTCCTTTTT, downstream forward: _UP4_TAATCATCATTTCTCTATCA