SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


25.79 kDa
protein length
222 aa Sequence Blast
gene length
669 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,078,643 3,079,311

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A814 (yteU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30090 ([gene|103A912E971E5760DBA45CC0681D77CED61D1FED|yteU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGCCCCCTCCTTTTT, downstream forward: _UP4_TAATCATCATTTCTCTATCA
  • BKK30090 ([gene|103A912E971E5760DBA45CC0681D77CED61D1FED|yteU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCGCCCCCTCCTTTTT, downstream forward: _UP4_TAATCATCATTTCTCTATCA