SubtiBank SubtiBank
ykwC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykwC

beta-hydroxyacid dehydrogenase
locus
BSU_13960
pI
5.11
mw
30.56 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
function
unknown
product
beta-hydroxyacid dehydrogenase
essential
no
ec
1.1.-.-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,465,733 1,466,599

    The protein

    Protein family

  • HIBADH-related family (with [protein|9F8A63C585227D59C8A5CD4356E3F81EB5897131|YfjR], according to UniProt)
  • Paralogous protein(s)

  • [protein|9F8A63C585227D59C8A5CD4356E3F81EB5897131|YfjR]:
  • Modification

  • phosphorylated on Ser-281 by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC], dephosphorylated by [protein|84447F9A6644EA8A7593BB99B2B69D4377E670E2|PrpC], phosphorylation abolishes the oxidoreductase activity of YkwC ''in vitro'' and ''in vivo'' [Pubmed|24390483]
  • Structure

  • [PDB|3WS7] (from ''Pyrobaculum calidifontis '', 42% identity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1010B1028A9A5F234C33474C7BC23C9BD2ABF3C4|ykwC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B333 (ykwC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1332 NBRP B. subtilis, Japan]
  • BKE13960 ([gene|1010B1028A9A5F234C33474C7BC23C9BD2ABF3C4|ykwC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGTCATTCCTCCCAGAT, downstream forward: _UP4_TAAAAAAAGATTGCCTGTAC
  • BKK13960 ([gene|1010B1028A9A5F234C33474C7BC23C9BD2ABF3C4|ykwC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGTCATTCCTCCCAGAT, downstream forward: _UP4_TAAAAAAAGATTGCCTGTAC
  • References

  • 24390483,15378759