SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


N-acetylglutamate synthase
43.20 kDa
protein length
406 aa Sequence Blast
gene length
1221 bp Sequence Blast
biosynthesis of arginine
N-acetylglutamate synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • Gene

    1,196,091 1,197,311

    The protein

    Catalyzed reaction/ biological activity

  • L-glutamate + N2-acetyl-L-ornithine --> L-ornithine + N-acetyl-L-glutamate (according to UniProt)
  • acetyl-CoA + L-glutamate --> CoA + H+ + N-acetyl-L-glutamate (according to UniProt)
  • Protein family

  • argJ family (single member, according to UniProt)
  • Structure

  • [PDB|1VZ6] (from ''Streptomyces clavuligerus'', 36% identity) [Pubmed|15352873]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, [Pubmed|1312212], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24843172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]) [Pubmed|1312212]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • BKE11200 ([gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTCGATTCTCTCCCG, downstream forward: _UP4_CGCACGTAATAAAGGGGAGC
  • BKK11200 ([gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTCGATTCTCTCCCG, downstream forward: _UP4_CGCACGTAATAAAGGGGAGC
  • References

  • 19649769,6096675,12107147,24843172,15352873,28516784,1312212,7511775