SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


D,L-endopeptidase, peptidoglycan hydrolase for cell separation
44.07 kDa
protein length
414 aa Sequence Blast
gene length
1245 bp Sequence Blast
cell separation
D,L-endopeptidase, peptidoglycan hydrolase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Endopeptidases]
  • Gene

    2,115,425 2,116,669

    The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Hydrolysis of gamma-D-glutamyl bonds to the L-terminus (position 7) of meso-diaminopimelic acid (meso-A(2)pm) in 7-(L-Ala-gamma-D-Glu)-meso-A(2)pm and 7-(L-Ala-gamma-D-Glu)-7-(D-Ala)-meso-A(2)pm. It is required that the D-terminal amino and carboxy groups of meso-A(2)pm are unsubstituted (according to UniProt)
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • contains four N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|24355088,18430080]
  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]
  • 4 [SW|LysM domain]s (aa 27-70, aa 88-131, aa 157-200, aa 225-268) (according to UniProt)
  • Effectors of protein activity

  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • Structure

  • [PDB|4XCM] (from Thermus thermophilus, 34% identity) [pubmed|25760608]
  • [SW|Localization]

  • localizes to cell septa and poles [Pubmed|22139507]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [pubmed|22139507], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [pubmed|22139507], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, synergistic transcription repression with [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB] [Pubmed|20817675], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, synergistic transcription repression with [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh] [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (3-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12850135]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-B424 (yojL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19410 ([gene|0FBE3F7ECACA7FCFAA4EE32E9B2BB35F0B793C0F|cwlS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTCAACCTCCTAAA, downstream forward: _UP4_TAAAAATGAGTATGACAAAA
  • BKK19410 ([gene|0FBE3F7ECACA7FCFAA4EE32E9B2BB35F0B793C0F|cwlS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTCAACCTCCTAAA, downstream forward: _UP4_TAAAAATGAGTATGACAAAA
  • References


  • 18430080,18266855
  • Original publications

  • 16855244,12850135,22139507,20817675,24355088,29458655,29458657,25760608