SubtiBank SubtiBank
cwlS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cwlS

D,L-endopeptidase, peptidoglycan hydrolase for cell separation
locus
BSU19410
pI
10.44
mw
44.07 kDa
protein length
414 aa Sequence Blast
gene length
1245 bp Sequence Blast
function
cell separation
product
D,L-endopeptidase, peptidoglycan hydrolase
essential
no
synonyms
yojL

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.4|Endopeptidases]
  • Gene

    Coordinates
    2,115,425 2,116,669

    The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • contains four N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|24355088,18430080]
  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]
  • Effectors of protein activity

  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • Structure

  • [PDB|4XCM] (from Thermus thermophilus, 34% identity) [pubmed|25760608]
  • [SW|Localization]

  • localizes to cell septa and poles [Pubmed|22139507]
  • Expression and Regulation

    Operons

    genes
    [gene|0FBE3F7ECACA7FCFAA4EE32E9B2BB35F0B793C0F|cwlS]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [pubmed|22139507], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [pubmed|22139507], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, synergistic transcription repression with [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB] [Pubmed|20817675], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, synergistic transcription repression with [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh] [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (3-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12850135]
  • view in new tab

    genes
    [gene|0FBE3F7ECACA7FCFAA4EE32E9B2BB35F0B793C0F|cwlS]-[gene|3B45734D18D01BAB6D244DE3547C84F9488075FB|yojM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B424 (yojL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1423 NBRP B. subtilis, Japan]
  • BKE19410 ([gene|0FBE3F7ECACA7FCFAA4EE32E9B2BB35F0B793C0F|cwlS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTCAACCTCCTAAA, downstream forward: _UP4_TAAAAATGAGTATGACAAAA
  • BKK19410 ([gene|0FBE3F7ECACA7FCFAA4EE32E9B2BB35F0B793C0F|cwlS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTCAACCTCCTAAA, downstream forward: _UP4_TAAAAATGAGTATGACAAAA
  • References

    Reviews

  • 18430080,18266855
  • Original publications

  • 16855244,12850135,22139507,20817675,24355088,29458655,29458657,25760608