SubtiBank SubtiBank
ypvA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypvA

similar to ATP-dependent helicase
locus
BSU_22150
pI
4.59
mw
74.12 kDa
protein length
641 aa Sequence Blast
gene length
1926 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    2,327,488 2,329,413

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|03BFD8AD2E3D95858752F46366F6C2028D709029|DinG]
  • Expression and Regulation

    Operons

    genes
    [gene|0F9B77CE6C662D2F249C7E33E5C553A74C390259|ypvA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A414 (ypvA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/414 NBRP B. subtilis, Japan]
  • BKE22150 ([gene|0F9B77CE6C662D2F249C7E33E5C553A74C390259|ypvA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAGTTCCAACCCCCAA, downstream forward: _UP4_TAATGGAAAAAAGCTGACGA
  • BKK22150 ([gene|0F9B77CE6C662D2F249C7E33E5C553A74C390259|ypvA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAGTTCCAACCCCCAA, downstream forward: _UP4_TAATGGAAAAAAGCTGACGA