SubtiBank SubtiBank
ypvA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypvA

similar to ATP-dependent helicase
locus
BSU_22150
pI
4.59
mw
74.12 kDa
protein length
641 aa Sequence Blast
gene length
1926 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    2,327,488 2,329,413

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|03BFD8AD2E3D95858752F46366F6C2028D709029|DinG]
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 29-303) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0F9B77CE6C662D2F249C7E33E5C553A74C390259|ypvA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A414 (ypvA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/414 NBRP B. subtilis, Japan]
  • BKE22150 ([gene|0F9B77CE6C662D2F249C7E33E5C553A74C390259|ypvA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAGTTCCAACCCCCAA, downstream forward: _UP4_TAATGGAAAAAAGCTGACGA
  • BKK22150 ([gene|0F9B77CE6C662D2F249C7E33E5C553A74C390259|ypvA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAGTTCCAACCCCCAA, downstream forward: _UP4_TAATGGAAAAAAGCTGACGA