SubtiBank SubtiBank
yvrO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvrO

similar to amino acid [SW|ABC transporter ](ATP-binding protein)
locus
BSU_33270
pI
9.70
mw
25.33 kDa
protein length
229 aa Sequence Blast
gene length
690 bp Sequence Blast
function
unknown
product
[SW|ABC transporter ](ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,413,350 3,414,039

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|464DD1855E6B3195EE242637612A16C73FF32FC0|PsdA], [protein|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|GlnQ], [protein|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|YtrE], [protein|6882EF93EC82872B25C88104F62D6603D2514890|ArtR], [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|YxdL], [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE], [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|BceA], [protein|B23CAC2563A36415C482AE2FA695E09228EF5B32|YclH], [protein|B24763A732111026D21C828FF9BE73FB22A123CF|TcyN], [protein|B453986691E1231A1C565D469A2A60EBFF2F6BD3|TcyC], [protein|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|YxeO], [protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|YknY]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 2-229) (according to UniProt)
  • Modification

  • phosphorylated on Arg-161 [Pubmed|22517742]
  • Structure

  • [PDB|1L2T] (from Methanocaldococcus jannaschii, 51% identity) [pubmed|12150914]
  • [SW|Localization]

  • membrane associated (via [protein|5AEDC5B857537B7D2A2637C0BC5BE78FD09A66B3|YvrN]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|7D334BBF7628D1DA001727CF7BEDB4EFA7FF88BA|yvrP]-[gene|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]-[gene|5AEDC5B857537B7D2A2637C0BC5BE78FD09A66B3|yvrN]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B057 (yvrO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1056 NBRP B. subtilis, Japan]
  • BKE33270 ([gene|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTATTCAGTGTCAGCATT, downstream forward: _UP4_AGCCATGCTTGAACATATTC
  • BKK33270 ([gene|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTATTCAGTGTCAGCATT, downstream forward: _UP4_AGCCATGCTTGAACATATTC
  • References

  • 10092453,11948146,22517742,20817675,12150914