SubtiBank SubtiBank
yvrO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvrO

similar to amino acid [SW|ABC transporter ](ATP-binding protein)
locus
BSU_33270
pI
9.70
mw
25.33 kDa
protein length
229 aa Sequence Blast
gene length
690 bp Sequence Blast
function
unknown
product
[SW|ABC transporter ](ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,413,350 3,414,039

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|464DD1855E6B3195EE242637612A16C73FF32FC0|PsdA], [protein|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|GlnQ], [protein|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|YtrE], [protein|6882EF93EC82872B25C88104F62D6603D2514890|ArtR], [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|YxdL], [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE], [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|BceA], [protein|B23CAC2563A36415C482AE2FA695E09228EF5B32|YclH], [protein|B24763A732111026D21C828FF9BE73FB22A123CF|TcyN], [protein|B453986691E1231A1C565D469A2A60EBFF2F6BD3|TcyC], [protein|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|YxeO], [protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|YknY]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 2-229) (according to UniProt)
  • Modification

  • phosphorylated on Arg-161 [Pubmed|22517742]
  • Structure

  • [PDB|1L2T] (from Methanocaldococcus jannaschii, 51% identity) [pubmed|12150914]
  • [SW|Localization]

  • membrane associated (via [protein|5AEDC5B857537B7D2A2637C0BC5BE78FD09A66B3|YvrN]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|7D334BBF7628D1DA001727CF7BEDB4EFA7FF88BA|yvrP]-[gene|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]-[gene|5AEDC5B857537B7D2A2637C0BC5BE78FD09A66B3|yvrN]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B057 (yvrO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1056 NBRP B. subtilis, Japan]
  • BKE33270 ([gene|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTATTCAGTGTCAGCATT, downstream forward: _UP4_AGCCATGCTTGAACATATTC
  • BKK33270 ([gene|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTATTCAGTGTCAGCATT, downstream forward: _UP4_AGCCATGCTTGAACATATTC
  • References

  • 10092453,11948146,22517742,20817675,12150914