SubtiBank SubtiBank
yunF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yunF

unknown
locus
BSU_32390
pI
6.27
mw
32.99 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,325,917 3,326,765

    The protein

    Protein family

  • UPF0759 family (single member, according to UniProt)
  • Structure

  • [PDB|1ZTV] (from Enterococcus faecalis, 44% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|9F1EC331167AED680621A27ABC49DC411F01144F|yunG]-[gene|0F3DA3A773B53ECBAAEB571FD566726C9A75A7B4|yunF]-[gene|26B4B215FAA2D91410F35852C418DA00261418CF|yunE]-[gene|A1C40F16DEB668FF3D7BF05E937FD4EEC3FE69C9|yunD]-[gene|F5E57D2FB348DAD9A65A1B1686742D1BA0E02C8F|yunC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|0F3DA3A773B53ECBAAEB571FD566726C9A75A7B4|yunF]-[gene|26B4B215FAA2D91410F35852C418DA00261418CF|yunE]-[gene|A1C40F16DEB668FF3D7BF05E937FD4EEC3FE69C9|yunD]-[gene|F5E57D2FB348DAD9A65A1B1686742D1BA0E02C8F|yunC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A982 (yunF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/982 NBRP B. subtilis, Japan]
  • BKE32390 ([gene|0F3DA3A773B53ECBAAEB571FD566726C9A75A7B4|yunF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATTCACCTCTCTT, downstream forward: _UP4_TTTTAGAAAAGAGGTTTTGA
  • BKK32390 ([gene|0F3DA3A773B53ECBAAEB571FD566726C9A75A7B4|yunF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATTCACCTCTCTT, downstream forward: _UP4_TTTTAGAAAAGAGGTTTTGA