SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


32.99 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,325,917 3,326,765

    The protein

    Protein family

  • UPF0759 family (single member, according to UniProt)
  • Structure

  • [PDB|1ZTV] (from Enterococcus faecalis, 44% identity)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A982 (yunF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32390 ([gene|0F3DA3A773B53ECBAAEB571FD566726C9A75A7B4|yunF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATTCACCTCTCTT, downstream forward: _UP4_TTTTAGAAAAGAGGTTTTGA
  • BKK32390 ([gene|0F3DA3A773B53ECBAAEB571FD566726C9A75A7B4|yunF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATTCACCTCTCTT, downstream forward: _UP4_TTTTAGAAAAGAGGTTTTGA