SubtiBank SubtiBank
yozZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yozZ

unknown, putative pseudogene
locus
BSU_18909
pI
0.00
mw
0.00 kDa
protein length
gene length
141 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,061,855 2,061,995

    Biological materials

    Mutant

  • BKE18909 ([gene|0F2A90937DC6833FD5D3ABCC96065AD438A2A34B|yozZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18909 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCATATCCAAAAGCAA, downstream forward: _UP4_TAAACCCCATACCCTTCTCT
  • BKK18909 ([gene|0F2A90937DC6833FD5D3ABCC96065AD438A2A34B|yozZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18909 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCATATCCAAAAGCAA, downstream forward: _UP4_TAAACCCCATACCCTTCTCT