SubtiBank SubtiBank
ylbQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylbQ

2-dehydropantoate 2-reductase
locus
BSU15110
pI
5.86
mw
33.13 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
function
biosynthesis of coenzyme A
product
2-dehydropantoate 2-reductase
essential
no
ec
1.1.1.169
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.4|Biosynthesis of coenzyme A]
  • Gene

    Coordinates
    1,577,409 1,578,305

    The protein

    Catalyzed reaction/ biological activity

  • (R)-pantoate + NADP+ = 2-dehydropantoate + NADPH (according to Swiss-Prot)
  • Protein family

  • ketopantoate reductase family (according to Swiss-Prot)
  • Structure

  • [PDB|3LGO]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|0F153803781C9AC8321FB14F926B645C45E53B00|ylbQ]-[gene|115FA333FAD17ACE5EBF288F16F33C330C6B4473|bshC]
    description
    [Pubmed|20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • ''[protein|search|ylbQ]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B254 (ylbQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1253 NBRP B. subtilis, Japan]
  • BKE15110 ([gene|0F153803781C9AC8321FB14F926B645C45E53B00|ylbQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTCACACCCAATTT, downstream forward: _UP4_TGAGCTTTTTCGGTAACATG
  • BKK15110 ([gene|0F153803781C9AC8321FB14F926B645C45E53B00|ylbQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTCACACCCAATTT, downstream forward: _UP4_TGAGCTTTTTCGGTAACATG
  • References

    Operon and expression

  • 20308541,23894131