SubtiBank SubtiBank
bacB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bacB

oxidase that catalyzes the synthesis of 2-oxo-3-(4-oxocyclohexa-2,5-dienyl)propanoic acid, a precursor to L-anticapsin
locus
BSU_37730
pI
5.19
mw
26.69 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast
function
biosynthesis of the antibiotic bacilysin
product
oxidase
essential
no
synonyms
ywfC,ipa-81d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    3,872,869 3,873,576

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of 2-oxo-3-(4-oxocyclohexa-2,5-dienyl)propanoic acid, a precursor to L-anticapsin [Pubmed|19776011]
  • 3-[(4R)-4-hydroxycyclohexa-1,5-dien-1-yl]-2-oxopropanoate --> 3-[(1E,4R)-4-hydroxycyclohex-2-en-1-ylidene]pyruvate (according to UniProt)
  • [SW|Domains]

  • 2 [SW|cupin 2 domain]s (aa 41 ... 106, aa 151 ... 216)
  • Structure

  • [PDB|3H7J] [Pubmed|19776011]
  • Expression and Regulation

    Operons

    genes
    [gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
    description
    [Pubmed|12372825]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B240 (ywfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1239 NBRP B. subtilis, Japan]
  • BKE37730 ([gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAATAAAGCTCCTGCATAT, downstream forward: _UP4_AAAATGAAGGCGGATGAATG
  • BKK37730 ([gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAATAAAGCTCCTGCATAT, downstream forward: _UP4_AAAATGAAGGCGGATGAATG
  • References

  • 15609023,12372825,21948839,19776011,19801406,20052993,20445239