SubtiBank SubtiBank
bacB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bacB

oxidase that catalyzes the synthesis of 2-oxo-3-(4-oxocyclohexa-2,5-dienyl)propanoic acid, a precursor to L-anticapsin
locus
BSU37730
pI
5.19
mw
26.69 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast
function
biosynthesis of the antibiotic bacilysin
product
oxidase
essential
no
synonyms
ywfC,ipa-81d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    3,872,869 3,873,576

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of 2-oxo-3-(4-oxocyclohexa-2,5-dienyl)propanoic acid, a precursor to L-anticapsin [Pubmed|19776011]
  • [SW|Domains]

  • 2 [SW|cupin 2 domain]s (aa 41 ... 106, aa 151 ... 216)
  • Structure

  • [PDB|3H7J] [Pubmed|19776011]
  • Expression and Regulation

    Operons

    genes
    [gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
    description
    [Pubmed|12372825]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B240 (ywfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1239 NBRP B. subtilis, Japan]
  • BKE37730 ([gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAATAAAGCTCCTGCATAT, downstream forward: _UP4_AAAATGAAGGCGGATGAATG
  • BKK37730 ([gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAATAAAGCTCCTGCATAT, downstream forward: _UP4_AAAATGAAGGCGGATGAATG
  • References

  • 15609023,12372825,21948839,19776011,19801406,20052993,20445239