SubtiBank SubtiBank
yfmK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfmK

Nε-lysine acetyltransferase, acetylation of the histone-like protein [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|HBsu]
locus
BSU_07440
pI
4.35
mw
17.17 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
acetylation of the histone-like protein [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|HBsu], regulation of nucleoid compaction
product
Nε-lysine acetyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.5|Protein acetylases/ deacetylases]
  • Gene

    Coordinates
    817,311 817,757

    The protein

    Catalyzed reaction/ biological activity

  • acetylation of [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|HBsu] on Lys-80, probably also on Lys-3, Lys-18, and Lys-41 [pubmed|30808761]
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 8-148) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0E6564B1B910694F28FD6EF5231E6F6A0E4BE545|yfmK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C240 (yfmK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2238 NBRP B. subtilis, Japan]
  • BKE07440 ([gene|0E6564B1B910694F28FD6EF5231E6F6A0E4BE545|yfmK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCCACCTCCGCGCA, downstream forward: _UP4_TGATCTCATCGAAACACAAA
  • BKK07440 ([gene|0E6564B1B910694F28FD6EF5231E6F6A0E4BE545|yfmK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCCACCTCCGCGCA, downstream forward: _UP4_TGATCTCATCGAAACACAAA
  • References

    Research papers

  • 30808761