SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to NAD(P)H dehydrogenase (quinone)
23.13 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
resistance to 2-methylhydroquinone

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    3,445,442 3,446,077

    The protein

    Catalyzed reaction/ biological activity

  • anthranilate + N,N-dimethyl-1,4-phenylenediamine + 2 NAD+ --> 2-(4-dimethylaminophenyl)diazenylbenzoate + 2 H+ + 2 NADH (according to UniProt)
  • Protein family

  • azoreductase type 1 family (with [protein|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|AzoR1], according to UniProt)
  • Paralogous protein(s)

  • [protein|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|AzoR1]
  • Structure

  • [PDB|3P0R] (from B. anthracis, 43% identity, 61% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725564], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]: repression, [Pubmed|17725564], in [regulon|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR regulon]
  • regulation

  • induced by catechol and 2-methylhydroquinone (2-MHQ) ([protein|search|MhqR]) [Pubmed|17725564]
  • view in new tab

    Biological materials


  • MGNA-A444 (yvaB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33540 ([gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTACCAGCCCTTTCG, downstream forward: _UP4_TAATGAAAAAGCCTCCCCTT
  • BKK33540 ([gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTACCAGCCCTTTCG, downstream forward: _UP4_TAATGAAAAAGCCTCCCCTT
  • References

  • 17725564,18208493,16497325,12107147,27965289