SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


sulphur compound N-deacetylase, required for the conversion of S-methyl-cysteine to cysteine
45.08 kDa
protein length
416 aa Sequence Blast
gene length
1251 bp Sequence Blast
utilization of S-methyl-cysteine
sulphur compound N-deacetylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|Conversion of S-methyl cysteine to cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    2,999,717 3,000,967

    Phenotypes of a mutant

  • a ''[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA] [gene|C99AA3FDBB561BCED60915078DC746690C071753|sndB] [gene|D1A8D231369F0BF48639B61094B3222EC4605B79|sndC]'' triple mutant does not grow with N-acetyl cysteine and S-(2-succino)cysteine as the single sources of sulfur [Pubmed|23944997,29626092]
  • The protein

    Protein family

  • [SW|peptidase M20 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C99AA3FDBB561BCED60915078DC746690C071753|SndB], [protein|D1A8D231369F0BF48639B61094B3222EC4605B79|SndC], [protein|D6F1906CE8386F78F451D6B794F74DE4AD25AC9C|YkuR]
  • Structure

  • [PDB|1YSJ] ([protein|C99AA3FDBB561BCED60915078DC746690C071753|SndB], 48% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • BKE29290 ([gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGACATATGTTCCGCTCCTT, downstream forward: _UP4_GATTGATATAGATGGGGTGT
  • BKK29290 ([gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGACATATGTTCCGCTCCTT, downstream forward: _UP4_GATTGATATAGATGGGGTGT
  • References

  • 16109943,15668000,15272571,23944997,29626092