SubtiBank SubtiBank
sndA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sndA

sulphur compound N-deacetylase, required for the conversion of S-methyl-cysteine to cysteine
locus
BSU_29290
pI
5.55
mw
45.08 kDa
protein length
416 aa Sequence Blast
gene length
1251 bp Sequence Blast
function
utilization of S-methyl-cysteine
product
sulphur compound N-deacetylase
essential
no
synonyms
hipO,ytnL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.1|Conversion of S-methyl cysteine to cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    2,999,717 3,000,967

    Phenotypes of a mutant

  • a ''[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA] [gene|C99AA3FDBB561BCED60915078DC746690C071753|sndB] [gene|D1A8D231369F0BF48639B61094B3222EC4605B79|sndC]'' triple mutant does not grow with N-acetyl cysteine and S-(2-succino)cysteine as the single sources of sulfur [Pubmed|23944997,29626092]
  • The protein

    Protein family

  • [SW|peptidase M20 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C99AA3FDBB561BCED60915078DC746690C071753|SndB], [protein|D1A8D231369F0BF48639B61094B3222EC4605B79|SndC], [protein|D6F1906CE8386F78F451D6B794F74DE4AD25AC9C|YkuR]
  • Structure

  • [PDB|1YSJ] ([protein|C99AA3FDBB561BCED60915078DC746690C071753|SndB], 48% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]-[gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]-[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]-[gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[gene|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM]-[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]-[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]-[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]-[gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]-[gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]-[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]-[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]
    description
    [Pubmed|15668000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • BKE29290 ([gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGACATATGTTCCGCTCCTT, downstream forward: _UP4_GATTGATATAGATGGGGTGT
  • BKK29290 ([gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGACATATGTTCCGCTCCTT, downstream forward: _UP4_GATTGATATAGATGGGGTGT
  • References

  • 16109943,15668000,15272571,23944997,29626092