SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, similar to glucose 1-dehydrogenase
29.28 kDa
protein length
273 aa Sequence Blast
gene length
822 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    4,091,845 4,092,666

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|YkvO], [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|YhxC], [protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|YhxD], [protein|B6FF689E65906186F3576B378650D713DB84EDDA|YcdF], [protein|EAEEA4DD9641919830A81185333A2610B964D37C|YhdF]
  • [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|BacC]:
  • [protein|B7B1D28E50244704324920E5A6F110DA8D63F6C0|YxjF]:
  • Structure

  • [PDB|4NBU] ([protein|439B468A13137000FB42E9389391CB4986FFED84|FabG] from Bacillus sp., 42% identity) [pubmed|24212572]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • MGNA-B694 (yxbG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39840 ([gene|0DD474462720CAEE2AE17017BD7CA385238EBC6F|yxbG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATACGAGACCTCCTTT, downstream forward: _UP4_TAAGAGAGGGAGCCCCCTCT
  • BKK39840 ([gene|0DD474462720CAEE2AE17017BD7CA385238EBC6F|yxbG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATACGAGACCTCCTTT, downstream forward: _UP4_TAAGAGAGGGAGCCCCCTCT
  • References

  • 11544224,24212572