SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


23.89 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,953,795 2,954,460

    Phenotypes of a mutant

  • the mutant forms more heat-resistant spores than the wild type strain [pubmed|32061128]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-B014 (yscB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28890 ([gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCAGGCTCCCTTCT, downstream forward: _UP4_TAAAATAAAAAAAGCCAAGG
  • BKK28890 ([gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCAGGCTCCCTTCT, downstream forward: _UP4_TAAAATAAAAAAAGCCAAGG
  • References

  • 15033535,20817675,32061128