SubtiBank SubtiBank
yscB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yscB

unknown
locus
BSU_28890
pI
8.06
mw
23.89 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,953,795 2,954,460

    Expression and Regulation

    Operons

    genes
    [gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B014 (yscB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1013 NBRP B. subtilis, Japan]
  • BKE28890 ([gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCAGGCTCCCTTCT, downstream forward: _UP4_TAAAATAAAAAAAGCCAAGG
  • BKK28890 ([gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCAGGCTCCCTTCT, downstream forward: _UP4_TAAAATAAAAAAAGCCAAGG
  • References

  • 15033535,20817675