SubtiBank SubtiBank
lip
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lip

extracellular lipase
locus
BSU02700
pI
10.06
mw
22.64 kDa
protein length
212 aa Sequence Blast
gene length
639 bp Sequence Blast
function
lipid degradation
product
extracellular lipase
essential
no
synonyms
lipA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.4|Utilization of lipids/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    292,205 292,843

    The protein

    Paralogous protein(s)

  • [protein|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|LipB]
  • Structure

  • [PDB|2QXT] [pubmed|18053819]
  • [PDB|1I6W]
  • Expression and Regulation

    Operons

    genes
    [gene|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during vegetative growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE02700 ([gene|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATCCTCCTTTTTTT, downstream forward: _UP4_TAATGAAAAACAAAACCTTG
  • BKK02700 ([gene|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATCCTCCTTTTTTT, downstream forward: _UP4_TAATGAAAAACAAAACCTTG
  • References

  • 22996591,22267088,23404771,21477088,22246996,23639749,21815947,24402332,15812018,12523966,18721749,12218047,16342303,12951259,11583117,11491291,18383241,19180538,8396026,19883129,18840696,18053819,24827611,12077437,25122499,25495458,26147762,26488405,27003415,27239434,27696241,28050632,18053819,30286107