SubtiBank SubtiBank
yxxD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxxD

antitoxin
locus
BSU_39290
pI
3.93
mw
17.52 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
inhibition of the cytotoxic activity of [protein|BD8C0563C7123B6DEC1EEB602BDF2C9D92D34991|YxiD]
product
antitoxin
essential
yes
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    4,036,344 4,036,787

    Phenotypes of a mutant

  • essential [Pubmed|28189581]
  • Expression and Regulation

    Operons

    genes
    [gene|75B0239578C92D4F3B298CBB077635BF5567C590|yxiB]-[gene|F44437883F39E5240D36340A7DD07803C5090ABB|yxiC]-[gene|BD8C0563C7123B6DEC1EEB602BDF2C9D92D34991|yxiD]-[gene|0DAFBDDC5E41592D06F97D404E75AF14B6783729|yxxD]-[gene|2710D9FD5FA50E09B4E482C13140F69B13C71861|yxxE]
    description
    [Pubmed|22383849,7883710,10746760]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B786 (yxxD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1785 NBRP B. subtilis, Japan]
  • BKE39290 ([gene|0DAFBDDC5E41592D06F97D404E75AF14B6783729|yxxD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATTTTTTTTTGCCTCC, downstream forward: _UP4_TGATTTTAACATTATCCCGT
  • BKK39290 ([gene|0DAFBDDC5E41592D06F97D404E75AF14B6783729|yxxD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATTTTTTTTTGCCTCC, downstream forward: _UP4_TGATTTTAACATTATCCCGT
  • References

  • 7883710,10746760,22200572,28189581