SubtiBank SubtiBank
dgk
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dgk

deoxyguanosine kinase
locus
BSU00150
pI
5.78
mw
24.00 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
function
purine salvage and interconversion
product
deoxyguanosine kinase
essential
no
ec
2.7.1.113
synonyms
yaaG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.3|Purine salvage and interconversion]
  • Gene

    Coordinates
    23,146 23,769

    The protein

    Catalyzed reaction/ biological activity

  • ATP + deoxyguanosine = ADP + dGMP. (according to SwissProt)
  • Protein family

  • DCK/DGK family (together woth [protein|D749382783437F40AE1C66755F57D44E3FCA193F|Dck]) (accoding to UniProt)
  • Paralogous protein(s)

  • [protein|D749382783437F40AE1C66755F57D44E3FCA193F|Dck]
  • Structure

  • [PDB|2JAQ] (DAK from Mycoplasma mycoides, 35% identity) [pubmed|17229440]
  • [SW|Localization]

  • cytoplasm (accoding to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0DA340B3D23B63C6BD284BF86409558A31B12B53|dgk]-[gene|D749382783437F40AE1C66755F57D44E3FCA193F|dck]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B888 (yaaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1887 NBRP B. subtilis, Japan]
  • BKE00150 ([gene|0DA340B3D23B63C6BD284BF86409558A31B12B53|dgk]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGAATCCTCCTTATAT, downstream forward: _UP4_GCCCATGTAAAGGAGCTTAT
  • BKK00150 ([gene|0DA340B3D23B63C6BD284BF86409558A31B12B53|dgk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGAATCCTCCTTATAT, downstream forward: _UP4_GCCCATGTAAAGGAGCTTAT
  • References

  • 11078735,17229440