SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


deoxyguanosine kinase
24.00 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
purine salvage and interconversion
deoxyguanosine kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Purine salvage and interconversion]
  • Gene

    23,146 23,769

    The protein

    Catalyzed reaction/ biological activity

  • ATP + deoxyguanosine = ADP + dGMP (according to UniProt)
  • Protein family

  • DCK/DGK family (together woth [protein|D749382783437F40AE1C66755F57D44E3FCA193F|Dck]) (accoding to UniProt)
  • Paralogous protein(s)

  • [protein|D749382783437F40AE1C66755F57D44E3FCA193F|Dck]
  • Structure

  • [PDB|2JAQ] (DAK from Mycoplasma mycoides, 35% identity) [pubmed|17229440]
  • [SW|Localization]

  • cytoplasm (accoding to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B888 (yaaG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00150 ([gene|0DA340B3D23B63C6BD284BF86409558A31B12B53|dgk]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGAATCCTCCTTATAT, downstream forward: _UP4_GCCCATGTAAAGGAGCTTAT
  • BKK00150 ([gene|0DA340B3D23B63C6BD284BF86409558A31B12B53|dgk]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGAATCCTCCTTATAT, downstream forward: _UP4_GCCCATGTAAAGGAGCTTAT
  • References

  • 11078735,17229440