SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


forespore-specific sporulation protein, similar to spore coat protein
11.15 kDa
protein length
gene length
300 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat protein/ based on similarity]
  • Gene

    2,754,820 2,755,119

    The protein

    Protein family

  • [SW|CotF family] (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • BKE26990 ([gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGATTCATGATTTATTCAT, downstream forward: _UP4_TAACATACAATGACTGATTT
  • BKK26990 ([gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGATTCATGATTTATTCAT, downstream forward: _UP4_TAACATACAATGACTGATTT
  • References

  • 16497325,30782632