SubtiBank SubtiBank
gerR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerR

probably DNA-binding protein, regulates transcription of some spore coat genes
locus
BSU15090
pI
7.11
mw
22.22 kDa
protein length
193 aa Sequence Blast
gene length
582 bp Sequence Blast
function
spore coat formation and resistance of spores to lysozyme
product
unknown
essential
no
synonyms
ylbO

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    1,576,129 1,576,710

    The protein

    Modification

  • phosphorylated on Ser-180 [Pubmed|20509597]
  • Expression and Regulation

    Operons

    genes
    [gene|0D7F5504590512E1598B94DC1734BF8FF67ED994|gerR]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|20435725], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE], [SW|SpoIIID]) [Pubmed|15699190,20435725]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B252 (ylbO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1251 NBRP B. subtilis, Japan]
  • BKE15090 ([gene|0D7F5504590512E1598B94DC1734BF8FF67ED994|gerR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTCAATCTCCCTCCAT, downstream forward: _UP4_TAAAGAAACGCCTGAAATGA
  • BKK15090 ([gene|0D7F5504590512E1598B94DC1734BF8FF67ED994|gerR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTCAATCTCCCTCCAT, downstream forward: _UP4_TAAAGAAACGCCTGAAATGA
  • References

  • 15383836,15621419,20435725,12850135,12107147,20509597