SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


phosphate [SW|ABC transporter ](ATP-binding protein)
29.05 kDa
protein length
260 aa Sequence Blast
gene length
783 bp Sequence Blast
high-affinity phosphate uptake
phosphate [SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • Gene

    2,577,210 2,577,992

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + phosphate --> ADP + H+ + 2 phosphate (according to UniProt)
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|434BCED6953BE07D592AC229264C5AD0D04CBAF6|PstBA], [protein|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|GlnQ], [protein|6882EF93EC82872B25C88104F62D6603D2514890|ArtR], [protein|B24763A732111026D21C828FF9BE73FB22A123CF|TcyN], [protein|B453986691E1231A1C565D469A2A60EBFF2F6BD3|TcyC], [protein|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|YxeO]
  • Structure

  • [PDB|4YMS] (from Caldanaerobacter subterraneus, 38% identity) [pubmed|25848002]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9098050], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]-P, [PubMed|9098050,9593301], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation (5000-fold induced) ([protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]) [,9593301 PubMed]
  • additional information

  • mRNA processing between [gene|BA45631351E3C9C140D15F620D7B7AC143C04932|pstS] and [gene|8BC7CCE9EBD899912ED7C72CA04FE82B21516F77|pstC] to maintain higher concentrations of [protein|BA45631351E3C9C140D15F620D7B7AC143C04932|PstS] relative to other components of the [SW|ABC transporter] [PubMed|15289558]
  • view in new tab

    Biological materials


  • MGNA-C450 (yqgK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24950 ([gene|0D5BC94E21D51373A50D61CE3D0895B3DB28F6B3|pstBB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTAGCAATACTCATTGCCG, downstream forward: _UP4_TGAAAAAAACAGGCTGAGTC
  • BKK24950 ([gene|0D5BC94E21D51373A50D61CE3D0895B3DB28F6B3|pstBB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTAGCAATACTCATTGCCG, downstream forward: _UP4_TGAAAAAAACAGGCTGAGTC
  • labs

  • [SW|Marion Hulett], University of Illinois at Chicago, USA [ Homepage]
  • References

  • 9098050,12897025,10913081,10092453,15289558,9098050,9593301,25848002