SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


part of the ymzE pseudogene
0.00 kDa
protein length
gene length
177 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    1,862,992 1,863,168

    Biological materials


  • BKE17267 ([gene|0D56AC7077B3CEFB5DD01C6EE1D0742A99FA93DD|ymzE/2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTACTAATCGTTCCGTCTT, downstream forward: _UP4_TAACAGCTGTCCGTCTCAGC
  • BKK17267 ([gene|0D56AC7077B3CEFB5DD01C6EE1D0742A99FA93DD|ymzE/2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTACTAATCGTTCCGTCTT, downstream forward: _UP4_TAACAGCTGTCCGTCTCAGC