SubtiBank SubtiBank
ymzE/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ymzE/2

part of the ymzE pseudogene
locus
BSU_17267
pI
0.00
mw
0.00 kDa
protein length
gene length
177 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    1,862,992 1,863,168

    Biological materials

    Mutant

  • BKE17267 ([gene|0D56AC7077B3CEFB5DD01C6EE1D0742A99FA93DD|ymzE/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17267 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTACTAATCGTTCCGTCTT, downstream forward: _UP4_TAACAGCTGTCCGTCTCAGC
  • BKK17267 ([gene|0D56AC7077B3CEFB5DD01C6EE1D0742A99FA93DD|ymzE/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17267 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTACTAATCGTTCCGTCTT, downstream forward: _UP4_TAACAGCTGTCCGTCTCAGC