SubtiBank SubtiBank
pchR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pchR

transcriptional repressor ([SW|MarR family]), controls the expression of genes involved in pulcherriminic acid biosynthesis
locus
BSU_35080
pI
8.09
mw
19.54 kDa
protein length
169 aa Sequence Blast
gene length
510 bp Sequence Blast
function
control of pulcherriminic acid biosynthesis
product
transcription factor ([SW|MarR family])
essential
no
synonyms
yzhA,yvmB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • Gene

    Coordinates
    3,604,993 3,605,502

    Phenotypes of a mutant

  • inactivation of ''[gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]'' causes widespread disruption of proteins involved in cellular processes that depend on iron availability, with pleiotropic effects on proteins associated with carbon metabolism, translation, stress response, biosynthesis of cell wall, and sporulation initiation [Pubmed|27542896]
  • The protein

    Protein family

  • [SW|MarR family] of transcriptional regulators [Pubmed|27542896]
  • Paralogous protein(s)

  • [protein|F5A59CE7727E0851652BB4C0144009154AB4978B|YhjH]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 10-153) (according to UniProt)
  • Additional information

  • Proposed consensus sequence for DNA-binding site: GTTYMMYMGTAAAC [Pubmed|27542896]
  • Expression and Regulation

    Operons

    genes
    [gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]-[gene|7F10DEEDEF8B679F4F2C5EAD5752F4E399DB0D57|yvmA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135]; [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR] auto-repression [Pubmed|27542896], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR]: repression, in [regulon|0D555F2AB7DC863E6FF388888308E980514DB719|PchR regulon]
  • regulation

  • induced by iron starvation [Pubmed|27542896]
  • view in new tab

    Biological materials

    Mutant

  • CS217 (''[gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s lab [Pubmed|27197833]
  • BKE35080 ([gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTACCTTCTTTCTT, downstream forward: _UP4_TAAACAAAAAGGCGGTGTAC
  • BKK35080 ([gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTACCTTCTTTCTT, downstream forward: _UP4_TAAACAAAAAGGCGGTGTAC
  • labs

  • Sandrine Auger, Micalis Institute, INRA, AgroParisTech, France
  • References

  • 12850135,22383849,27542896,27197833