SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional repressor ([SW|MarR family]), controls the expression of genes involved in pulcherriminic acid biosynthesis
19.54 kDa
protein length
169 aa Sequence Blast
gene length
510 bp Sequence Blast
control of pulcherriminic acid biosynthesis
transcription factor ([SW|MarR family])

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|Acquisition of iron / Other]
  • Gene

    3,604,993 3,605,502

    Phenotypes of a mutant

  • inactivation of ''[gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]'' causes widespread disruption of proteins involved in cellular processes that depend on iron availability, with pleiotropic effects on proteins associated with carbon metabolism, translation, stress response, biosynthesis of cell wall, and sporulation initiation [Pubmed|27542896]
  • The protein

    Protein family

  • [SW|MarR family] of transcriptional regulators [Pubmed|27542896]
  • Paralogous protein(s)

  • [protein|F5A59CE7727E0851652BB4C0144009154AB4978B|YhjH]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 10-153) (according to UniProt)
  • Additional information

  • Proposed consensus sequence for DNA-binding site: GTTYMMYMGTAAAC [Pubmed|27542896]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135]; [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR] auto-repression [Pubmed|27542896], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR]: repression, in [regulon|0D555F2AB7DC863E6FF388888308E980514DB719|PchR regulon]
  • regulation

  • induced by iron starvation [Pubmed|27542896]
  • view in new tab

    Biological materials


  • CS217 (''[gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s lab [Pubmed|27197833]
  • BKE35080 ([gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTACCTTCTTTCTT, downstream forward: _UP4_TAAACAAAAAGGCGGTGTAC
  • BKK35080 ([gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTACCTTCTTTCTT, downstream forward: _UP4_TAAACAAAAAGGCGGTGTAC
  • labs

  • Sandrine Auger, Micalis Institute, INRA, AgroParisTech, France
  • References

  • 12850135,22383849,27542896,27197833