SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


isochorismate synthase
43.29 kDa
protein length
398 aa Sequence Blast
gene length
1197 bp Sequence Blast
biosynthesis of the siderophore bacillibactin
isochorismate synthase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|Acquisition of iron / Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    3,290,289 3,291,485

    Phenotypes of a mutant

  • defective in biofilm formation, this can be suppressed by the addition of 2,3-dihydroxybenzoate to the medium [pubmed|31420537]
  • The protein

    Catalyzed reaction/ biological activity

  • Chorismate --> isochorismate (according to UniProt)
  • Protein family

  • isochorismate synthase family (with [protein|8EFE4D2B07E54A0EE7D6821C9FEBFC7DC22FDE03|MenF], according to UniProt)
  • Modification

  • phosphorylation on Ser-271 [Pubmed|17218307]
  • Structure

  • [PDB|3OS6], (from ''B. anthracis'', 56% identity, 70% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [pubmed|29914988], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre]: repression, in [regulon|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre regulon]
  • regulation

  • induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the ''[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]'' operon is strongly unregulated in a ''[SW|kre]'' mutant [Pubmed|26110430]
  • view in new tab

    Biological materials


  • BKE31990 ([gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCATGAACCTCCTTT, downstream forward: _UP4_TGAACAGAATGAATTGCTGG
  • BKK31990 ([gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCATGAACCTCCTTT, downstream forward: _UP4_TGAACAGAATGAATTGCTGG
  • References

  • 8224884,11112781,11790741,12354229,17218307,8921902,8550523,20817675,21815947,26110430,29133393,29914988,31420537