SubtiBank SubtiBank
dhbC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dhbC

isochorismate synthase
locus
BSU_31990
pI
5.17
mw
43.29 kDa
protein length
398 aa Sequence Blast
gene length
1197 bp Sequence Blast
function
biosynthesis of the siderophore bacillibactin
product
isochorismate synthase
essential
no
ec
5.4.4.2
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,290,289 3,291,485

    The protein

    Catalyzed reaction/ biological activity

  • Chorismate --> isochorismate (according to UniProt)
  • Protein family

  • isochorismate synthase family (with [protein|8EFE4D2B07E54A0EE7D6821C9FEBFC7DC22FDE03|MenF], according to UniProt)
  • Modification

  • phosphorylation on Ser-271 [Pubmed|17218307]
  • Structure

  • [PDB|3OS6], (from ''B. anthracis'', 56% identity, 70% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]-[gene|DD647083C2E6968AD26A41C9F4EFBA942D75207C|ybdZ]
    description
    [Pubmed|8921902]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [pubmed|29914988], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre]: repression, in [regulon|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre regulon]
  • regulation

  • induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the ''[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]'' operon is strongly unregulated in a ''[SW|kre]'' mutant [Pubmed|26110430]
  • view in new tab

    Biological materials

    Mutant

  • BKE31990 ([gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCATGAACCTCCTTT, downstream forward: _UP4_TGAACAGAATGAATTGCTGG
  • BKK31990 ([gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCATGAACCTCCTTT, downstream forward: _UP4_TGAACAGAATGAATTGCTGG
  • References

  • 8224884,11112781,11790741,12354229,17218307,8921902,8550523,20817675,21815947,26110430,29133393,29914988