SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


UDP-2,6-dideoxy 2-acetamido 4-keto glucose aminotransferase, required for extracellular polysaccharide synthesis
42.76 kDa
protein length
388 aa Sequence Blast
gene length
1167 bp Sequence Blast
[category|SW 4.1.2|Biofilm formation], biosynthesis of N,N'-diacetylbacillosamine
UDP-2,6-dideoxy 2-acetamido 4-keto glucose aminotransferase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Matrix polysaccharide synthesis]
  • Gene

    3,515,062 3,516,228

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • The protein

    Catalyzed reaction/ biological activity

  • conversion of UDP-2,6-dideoxy 2-acetamido 4-keto glucose to UDP-2,6-dideoxy 2-acetamido 4-amino glucose [pubmed|29982582]
  • Protein family

  • DegT/DnrJ/EryC1 family (with [protein|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|NtdA] and [protein|38DBA751456A0C0EC5D028939ADB8860ADA28F94|SpsC], according to UniProt)
  • [SW|Cofactors]

  • pyridoxal phosphate [pubmed|29982582]
  • Structure

  • [PDB|1O61] (from Campylobacter jejuni, 46% identity) [SW|16021622]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541]
  • expression is increased in [gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX] mutants [pubmed|32483306]
  • view in new tab

    Biological materials


  • MGNA-A064 (yvfE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34230 ([gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAGTAGATTTTTTTATGCA, downstream forward: _UP4_TTCCATACTGTCGAGGTGAA
  • BKK34230 ([gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAGTAGATTTTTTTATGCA, downstream forward: _UP4_TTCCATACTGTCGAGGTGAA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • References


  • 20735481
  • Research papers

  • 29982582,30222950,16021622
  • The EAR [SW|RNA switch]

  • 20374491,20230605