SubtiBank SubtiBank
swrAA/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

swrAA/2

control of DegU activity, enhances sigD transcription, part of the swrAA pseudogene
locus
BSU_35239
pI
0.00
mw
0.00 kDa
protein length
gene length
117 bp Sequence Blast
function
essential for swarming differentiation on solid surfaces
product
swarming motility protein
essential
no
synonyms
Outlinks

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    3,621,931 3,622,047

    The protein

  • see [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]
  • Expression and Regulation

    Operons

    genes
    [gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]-[gene|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ]
    description
    [Pubmed|16030230]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18567663], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|18567663], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, ([protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA] promoter) [Pubmed|18567663], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab

    genes
    [gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]-[gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|18567663], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18567663], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, ([protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA] promoter) [Pubmed|18567663], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • additional information

  • SwrA levels are 3 ... 10-fold increased on solid medium as compared to liquid medium (due to [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA]/[protein|A6E7212D159F076F5D26F9C02F340B40C3667623|SmiA]-mediated degradation of SwrA in liquid medium) [PubMed|25538299]
  • view in new tab

    Biological materials

  • see [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]
  • Mutant

  • BKE35239 ([gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35239 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGCTAACGTTACTC, downstream forward: _UP4_GGTTCACAATTGAAGAGGGC
  • BKK35239 ([gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35239 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGCTAACGTTACTC, downstream forward: _UP4_GGTTCACAATTGAAGAGGGC
  • labs

  • see [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]
  • References

  • see [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]