SubtiBank SubtiBank
yugN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yugN

unknown
locus
BSU_31330
pI
4.10
mw
14.98 kDa
protein length
134 aa Sequence Blast
gene length
405 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,219,837 3,220,241

    The protein

    Structure

  • [PDB|2PWW] (from B. clausii, 31% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi]-[gene|BD63E58F9CF99F9A1888099F3393B30DE3F164F5|yugM]-[gene|0C8E5DFD40F4B2EB540199DFB2520E3FBC878530|yugN]
    description
    [Pubmed|11489127]

    regulation

  • constitutively expressed [Pubmed|11489127]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A618 (yugN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/618 NBRP B. subtilis, Japan]
  • BKE31330 ([gene|0C8E5DFD40F4B2EB540199DFB2520E3FBC878530|yugN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGAATGCCCCTTTTTT, downstream forward: _UP4_GAATTGGAGGATGTTCTGTT
  • BKK31330 ([gene|0C8E5DFD40F4B2EB540199DFB2520E3FBC878530|yugN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGAATGCCCCTTTTTT, downstream forward: _UP4_GAATTGGAGGATGTTCTGTT
  • References

  • 11489127