SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


glucosamine-6-phosphate deaminase
26.84 kDa
protein length
242 aa Sequence Blast
gene length
729 bp Sequence Blast
N-acetylglucosamine utilization
glucosamine-6-phosphate deaminase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Utilization of cell wall components]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • Gene

    3,596,543 3,597,271

    The protein

    Catalyzed reaction/ biological activity

  • α-D-glucosamine 6-phosphate + H2O --> β-D-fructose 6-phosphate + NH4+ (according to UniProt)
  • Protein family

  • glucosamine/galactosamine-6-phosphate isomerase family (with [protein|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|GamA], according to UniProt)
  • Paralogous protein(s)

  • [protein|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|GamA]
  • Structure

  • [PDB|2BKX] [Pubmed|15755726]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR]: repression, [Pubmed|24673833,21602348], in [regulon|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of N-acetylglucosamine ([protein|search|NagR]) [Pubmed|24673833,21602348,14343123]
  • view in new tab

    Biological materials


  • MGNA-A336 (nagB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35020 ([gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACGTTTGACATTCCATTA, downstream forward: _UP4_CCTTGAAAGGAACATGCTGA
  • BKK35020 ([gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACGTTTGACATTCCATTA, downstream forward: _UP4_CCTTGAAAGGAACATGCTGA
  • References


  • 26159076
  • Original publications

  • 6174502,15755726,21821766,21602348,23667565,24673833,23876412,25564531