tmcAL

tRNA^Met cytidine acetate ligase, required for proper decoding of the AUA elongator Met codon

locus: BSU_15060

pI: 7.80

mw: 46.83 kDa

protein length: 415 aa

gene length: 1248 bp

function: acetylation of elongator tRNA^Met

product: tRNA^Met cytidine acetate ligase

essential: no

synonyms: ylbM

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]

Gene

Coordinates: 1,573,807 1,575,054

Phenotypes of a mutant

• cold-sensitive [pubmed|30150682]
• restores viability of a ''[gene|0136394A52759CEEDD8DE074ED74033C6FFB8435|smc]'' mutant on rich medium due to the induction of a [SW|stringent response] [Pubmed|26539825]

The protein

Catalyzed reaction/ biological activity

• acetylation of the first position of the anticodon (position 34) of elongator tRNA^Met [pubmed|30150682]
• acetate + ATP + cytidine³⁴ in elongator tRNA^Met --> AMP + diphosphate + N⁴-acetylcytidine³⁴ in elongator tRNA^Met (according to UniProt)

Protein family

• TmcAL family (single member, according to UniProt)

Structure

• [PDB|5Y0O] (apo-form) [pubmed|30150682]
• [PDB|5Y0P] (bound to alpha-thio ATP) [pubmed|30150682]
• [PDB|5Y0Q] (bound to AMPCPP) [pubmed|30150682]
• [PDB|5Y0N] (selenomethionine derivative) [pubmed|30150682]

Expression and Regulation

Operons

• genes: [gene|0311601A6499C5B5A84690242132AC4AC1D36B26|ylzH]-[gene|0C76CAE27ACEBC0FF6B864B9F8C7D3C41C8D2A24|tmcAL]
  description: [pubmed|22383849]

Biological materials

Mutant

• MGNA-B250 (ylbM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1249 NBRP B. subtilis, Japan]
• BKE15060 ([gene|0C76CAE27ACEBC0FF6B864B9F8C7D3C41C8D2A24|tmcAL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAACCACCAATCCGACAG, downstream forward: _UP4_AATGTATAGAAAAAGCACCT
• BKK15060 ([gene|0C76CAE27ACEBC0FF6B864B9F8C7D3C41C8D2A24|tmcAL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAACCACCAATCCGACAG, downstream forward: _UP4_AATGTATAGAAAAAGCACCT

References

• 26539825,30150682