SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


34.10 kDa
protein length
320 aa Sequence Blast
gene length
963 bp Sequence Blast
utilization of sucrose and glucitol

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of sucrose]
  • Gene

    670,087 671,049

    The protein

    Catalyzed reaction/ biological activity

  • Fru Fru-6-P
  • Protein family

  • [SW|carbohydrate kinase PfkB family] (according to UniProt)
  • Structure

  • [PDB|5EY7] (from Vibrio cholerae, 38% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8195086], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|926BCA197F259558F72FDCC73998497B9B167D22|GutR]: activation, [Pubmed|8195086], in [regulon|926BCA197F259558F72FDCC73998497B9B167D22|GutR regulon]
  • regulation

  • induced by glucitol ([protein|926BCA197F259558F72FDCC73998497B9B167D22|GutR]) [Pubmed|8195086]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-C213 (ydjE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06170 ([gene|0C4F0C9EF18FB4E9BB5BC3F53F7DDF5F32B51FA5|fruC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCACACTCATTTA, downstream forward: _UP4_TAAATCATTGAAGATGTTTC
  • BKK06170 ([gene|0C4F0C9EF18FB4E9BB5BC3F53F7DDF5F32B51FA5|fruC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCACACTCATTTA, downstream forward: _UP4_TAAATCATTGAAGATGTTTC