SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


RNA pyrophosphohydrolase, converts primary transcripts to 5’-monophosphate RNA
18.07 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
initiation of RNA degradation
RNA pyrophosphohydrolase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW|RNA pyrophosphohydrolase]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
  • Gene

    3,572,413 3,572,889

    The protein

    Catalyzed reaction/ biological activity

  • converts primary transcripts to 5’-monophospate RNA [pubmed|31740579]
  • prefers G-initiating RNAs and required at least one unpaired nucleotide at the 5’-end of its substrates, with the 5’-terminal nucleotide determining whether primarily ortho- or pyrophosphate is released [pubmed|31740579]
  • Protein family

  • [SW|Nudix hydrolase] (according to UniProt)
  • [SW|Domains]

  • [SW|Nudix hydrolase domain] (aa 3-130) (according to UniProt)
  • [SW|Cofactors]

  • Mn2+ [pubmed|31740579]
  • Structure

  • [PDB|3FK9] (the protein from ''B. halodurans'', 59% identity/ 82% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-B642 (yvcI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34780 (Δ[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAACCTTCGTCCTGTC, downstream forward: _UP4_TAGAAAGACAAGTCAGGGGG
  • BKK34780 (Δ[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAACCTTCGTCCTGTC, downstream forward: _UP4_TAGAAAGACAAGTCAGGGGG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 12850135,9237995,16272399,20525796,31740579