SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|Nudix hydrolase]
18.07 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    3,572,413 3,572,889

    The protein

    Protein family

  • [SW|Nudix hydrolase] (according to UniProt)
  • [SW|Domains]

  • [SW|Nudix hydrolase domain] (aa 3-130) (according to UniProt)
  • Structure

  • [PDB|3FK9] (the protein from ''B. halodurans'', 59% identity/ 82% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-B642 (yvcI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34780 (Δ[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|yvcI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAACCTTCGTCCTGTC, downstream forward: _UP4_TAGAAAGACAAGTCAGGGGG
  • BKK34780 (Δ[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|yvcI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAACCTTCGTCCTGTC, downstream forward: _UP4_TAGAAAGACAAGTCAGGGGG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 12850135,9237995,16272399,20525796