SubtiBank SubtiBank
nahA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

nahA

RNA pyrophosphohydrolase, converts primary transcripts to 5’-monophosphate RNA
locus
BSU_34780
pI
4.99
mw
18.07 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
function
initiation of RNA degradation
product
RNA pyrophosphohydrolase
essential
no
synonyms
yvcI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.3|RNA pyrophosphohydrolase]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
  • Gene

    Coordinates
    3,572,413 3,572,889

    The protein

    Catalyzed reaction/ biological activity

  • converts primary transcripts to 5’-monophospate RNA [pubmed|31740579]
  • prefers G-initiating RNAs and required at least one unpaired nucleotide at the 5’-end of its substrates, with the 5’-terminal nucleotide determining whether primarily ortho- or pyrophosphate is released [pubmed|31740579]
  • Protein family

  • [SW|Nudix hydrolase] (according to UniProt)
  • [SW|Domains]

  • [SW|Nudix hydrolase domain] (aa 3-130) (according to UniProt)
  • [SW|Cofactors]

  • Mn2+ [pubmed|31740579]
  • Structure

  • [PDB|3FK9] (the protein from ''B. halodurans'', 59% identity/ 82% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]-[gene|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|yvcJ]-[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]-[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA]-[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]-[gene|C521BEE1EEEA7AD283A3C47C34301A8603CD9188|yvcN]
    description
    [Pubmed|9237995]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B642 (yvcI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1641 NBRP B. subtilis, Japan]
  • BKE34780 (Δ[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAACCTTCGTCCTGTC, downstream forward: _UP4_TAGAAAGACAAGTCAGGGGG
  • BKK34780 (Δ[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAACCTTCGTCCTGTC, downstream forward: _UP4_TAGAAAGACAAGTCAGGGGG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 12850135,9237995,16272399,20525796,31740579