SubtiBank SubtiBank
ydgC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydgC

similar to transcription factor ([SW|TetR family])
locus
BSU_05580
pI
5.57
mw
21.92 kDa
protein length
195 aa Sequence Blast
gene length
588 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    603,012 603,599

    The protein

    Protein family

  • [SW|TetR family]
  • [SW|Domains]

  • [SW|HTH tetR-type domain] (aa 6-66) (according to UniProt)
  • Structure

  • [PDB|5GPA] ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR] from B. halodurans, 26% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|0C2CD998B933D7458DBC4E80A596801274AC43F9|ydgC]-[gene|6DD46B2E342994CB97C13C00AB264B2D62184223|ydgD]-[gene|07A30814F57112196051289AA309AE6DB22CAEFF|ydgE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C157 (ydgC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2155 NBRP B. subtilis, Japan]
  • BKE05580 ([gene|0C2CD998B933D7458DBC4E80A596801274AC43F9|ydgC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTAGGACCACCCCAAAA, downstream forward: _UP4_CTTCCGAAAGGGAATGATGT
  • BKK05580 ([gene|0C2CD998B933D7458DBC4E80A596801274AC43F9|ydgC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTAGGACCACCCCAAAA, downstream forward: _UP4_CTTCCGAAAGGGAATGATGT