SubtiBank SubtiBank
pgpB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pgpB

phosphatidylglycerol phosphate (PGP) phosphatase , has minor undecaprenyl pyrophosphate phosphatase activity
locus
BSU_19650
pI
10.14
mw
22.64 kDa
protein length
203 aa Sequence Blast
gene length
612 bp Sequence Blast
function
phospholipid biosynthesis
product
phosphatidylglycerol phosphate (PGP) phosphatase
essential
no

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,136,913 2,137,524

    The protein

    Catalyzed reaction/ biological activity

  • 1,2-diacyl-sn-glycero-3-phospho-(1ʼ-sn-glycero-3ʼ-phosphate) + H2O --> 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) + phosphate (according to UniProt)
  • Protein family

  • PA-phosphatase related phosphoesterase family (single member, according to UniProt)
  • Structure

  • [PDB|5JKI] [Pubmed|28168443]
  • [SW|Localization]

  • cell membrane (integral) [Pubmed|28168443]
  • Expression and Regulation

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B441 (pgpB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1440 NBRP B. subtilis, Japan]
  • BKE19650 ([gene|0BF97861B52722347C4BBE533E574CF548A8283E|pgpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTAACCACCTCAATT, downstream forward: _UP4_TAGAGAGAGGAAAACACAGC
  • BKK19650 ([gene|0BF97861B52722347C4BBE533E574CF548A8283E|pgpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTAACCACCTCAATT, downstream forward: _UP4_TAGAGAGAGGAAAACACAGC
  • References

  • 27528508,28168443,26883633