SubtiBank SubtiBank
pgpB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pgpB

phosphatidylglycerol phosphate (PGP) phosphatase , has minor undecaprenyl pyrophosphate phosphatase activity
locus
BSU_19650
pI
10.14
mw
22.64 kDa
protein length
203 aa Sequence Blast
gene length
612 bp Sequence Blast
function
phospholipid biosynthesis
product
phosphatidylglycerol phosphate (PGP) phosphatase
essential
no

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,136,913 2,137,524

    The protein

    Catalyzed reaction/ biological activity

  • 1,2-diacyl-sn-glycero-3-phospho-(1ʼ-sn-glycero-3ʼ-phosphate) + H2O --> 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) + phosphate (according to UniProt)
  • Protein family

  • PA-phosphatase related phosphoesterase family (single member, according to UniProt)
  • Structure

  • [PDB|5JKI] [Pubmed|28168443]
  • [SW|Localization]

  • cell membrane (integral) [Pubmed|28168443]
  • Expression and Regulation

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • GP3652 Δ[gene|0BF97861B52722347C4BBE533E574CF548A8283E|pgpB]::cat, available in [SW|Jörg Stülke]'s lab
  • MGNA-B441 (pgpB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1440 NBRP B. subtilis, Japan]
  • BKE19650 ([gene|0BF97861B52722347C4BBE533E574CF548A8283E|pgpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTAACCACCTCAATT, downstream forward: _UP4_TAGAGAGAGGAAAACACAGC
  • BKK19650 ([gene|0BF97861B52722347C4BBE533E574CF548A8283E|pgpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTAACCACCTCAATT, downstream forward: _UP4_TAGAGAGAGGAAAACACAGC
  • Expression vector

  • pGP3502: IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [https://www.thermofisher.com/order/catalog/product/K30001#/K30001 pETSUMOadapt], available in [SW|Jörg Stülke]'s lab
  • pGP3503: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • pGP3506 (N-terminal His-tag, expression in ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 27528508,28168443,26883633