SubtiBank SubtiBank
yodM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yodM

minor undecaprenyl pyrophosphate phosphatase, not active under standard conditions
locus
BSU_19650
pI
10.14
mw
22.64 kDa
protein length
203 aa Sequence Blast
gene length
612 bp Sequence Blast
function
unknown
product
minor undecaprenyl pyrophosphate phosphatase
essential
no
synonyms
yodM

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,136,913 2,137,524

    The protein

    Catalyzed reaction/ biological activity

  • 1,2-diacyl-sn-glycero-3-phospho-(1ʼ-sn-glycero-3ʼ-phosphate) + H2O --> 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) + phosphate (according to UniProt)
  • Protein family

  • PA-phosphatase related phosphoesterase family (single member, according to UniProt)
  • Structure

  • [PDB|5JKI] [Pubmed|28168443]
  • [SW|Localization]

  • cell membrane (integral) [Pubmed|28168443]
  • Expression and Regulation

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B441 (pgpB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1440 NBRP B. subtilis, Japan]
  • BKE19650 ([gene|0BF97861B52722347C4BBE533E574CF548A8283E|yodM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTAACCACCTCAATT, downstream forward: _UP4_TAGAGAGAGGAAAACACAGC
  • BKK19650 ([gene|0BF97861B52722347C4BBE533E574CF548A8283E|yodM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTAACCACCTCAATT, downstream forward: _UP4_TAGAGAGAGGAAAACACAGC
  • References

  • 27528508,28168443,26883633