SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


major extracellular alkaline protease
39.37 kDa
protein length
381 aa Sequence Blast
gene length
1146 bp Sequence Blast
protein degradation
extracellular alkaline serine protease (subtilisin E)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Extracellular feeding proteases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,104,423 1,105,568

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of proteins with broad specificity for peptide bonds, and a preference for a large uncharged residue in P1. Hydrolyzes peptide amides(according to UniProt)
  • Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • Inhibitor I9 domain (aa 38-109) (according to UniProt)
  • [SW|Peptidase S8 domain] (aa 111-380) (according to UniProt)
  • Structure

  • [PDB|1SBC]
  • [SW|Localization]

  • secreted (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2447063], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|1898931], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|1906467], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|2504584], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|12950930,15598897,2447063], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|26728191], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|1898931]
  • induced in the presence of external [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|ComX] [pubmed|29449835]
  • additional information

  • in a triple ''[SW|abrB] [SW|codY] [SW|scoC]'' mutant, expression occurs during exponential growth [Pubmed|26728191]
  • view in new tab

    additional information

  • expression is increased in a [gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag] mutant due to the presence of increased levels of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P [pubmed|28800172]
  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • KO7 (''nprE aprE epr mpr nprB vpr bpr''), available as BGSC 1A1133
  • BKE10300 ([gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCTTTACCCTCTCCTTT, downstream forward: _UP4_TAATAGTAAAAAGAAGCAGG
  • BKK10300 ([gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCTTTACCCTCTCCTTT, downstream forward: _UP4_TAATAGTAAAAAGAAGCAGG
  • Antibody

  • **
  • References


  • 20735481
  • Original publications

  • 19710937,3082852,2447063,2447062,19251843,18414485,6322190,12884008,15126467,1898931,1906467,2504584,18957862,11101663,12055299,3131303,1906467,15598897,11325965,14688235,21099137,22745669,23563549,23563567,24115457,25315053,12950930,26728191,28800172,29449835,24279884