SubtiBank SubtiBank
aprE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aprE

major extracellular alkaline protease
locus
BSU_10300
pI
9.34
mw
39.37 kDa
protein length
381 aa Sequence Blast
gene length
1146 bp Sequence Blast
function
protein degradation
product
extracellular alkaline serine protease (subtilisin E)
essential
no
synonyms
sprE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.5|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.2|Extracellular feeding proteases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,104,423 1,105,568

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of proteins with broad specificity for peptide bonds, and a preference for a large uncharged residue in P1. Hydrolyzes peptide amides(according to UniProt)
  • Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • Inhibitor I9 domain (aa 38-109) (according to UniProt)
  • [SW|Peptidase S8 domain] (aa 111-380) (according to UniProt)
  • Structure

  • [PDB|1SBC]
  • [SW|Localization]

  • secreted (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2447063], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|1898931], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|1906467], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|2504584], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|12950930,15598897,2447063], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|26728191], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|1898931]
  • induced in the presence of external [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|ComX] [pubmed|29449835]
  • additional information

  • in a triple ''[SW|abrB] [SW|codY] [SW|scoC]'' mutant, expression occurs during exponential growth [Pubmed|26728191]
  • view in new tab

    additional information

  • expression is increased in a [gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag] mutant due to the presence of increased levels of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P [pubmed|28800172]
  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • KO7 (''nprE aprE epr mpr nprB vpr bpr''), available as BGSC 1A1133
  • BKE10300 ([gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCTTTACCCTCTCCTTT, downstream forward: _UP4_TAATAGTAAAAAGAAGCAGG
  • BKK10300 ([gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCTTTACCCTCTCCTTT, downstream forward: _UP4_TAATAGTAAAAAGAAGCAGG
  • Antibody

  • **
  • References

    Reviews

  • 20735481
  • Original publications

  • 19710937,3082852,2447063,2447062,19251843,18414485,6322190,12884008,15126467,1898931,1906467,2504584,18957862,11101663,12055299,3131303,1906467,15598897,11325965,14688235,21099137,22745669,23563549,23563567,24115457,25315053,12950930,26728191,28800172,29449835,24279884