SubtiBank SubtiBank
sspG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sspG

small acid-soluble spore protein (minor)
locus
BSU_32640
pI
4.25
mw
5.14 kDa
protein length
gene length
147 bp Sequence Blast
function
protection of spore DNA
product
small acid-soluble spore protein (minor)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.3|Small acid-soluble spore proteins]
  • Gene

    Coordinates
    3,354,066 3,354,212

    Expression and Regulation

    Operons

    genes
    [gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]
    description
    [Pubmed|9852018]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,9852018], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|9852018], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,9852018]
  • view in new tab

    genes
    [gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]-[gene|B46AB216DE0828E4CD5714CADE5C25C1B5AF75DC|yurS]
    description
    [Pubmed|9852018]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,9852018], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|9852018], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,9852018]
  • view in new tab

    Biological materials

    Mutant

  • BKE32640 ([gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTATCATCCTTTCTCT, downstream forward: _UP4_CAGTCACAAGACGGAGAAGA
  • BKK32640 ([gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTATCATCCTTTCTCT, downstream forward: _UP4_CAGTCACAAGACGGAGAAGA
  • References

  • 9852018,15699190,12850135,27766092