SubtiBank SubtiBank


protein serine phosphatase, environmental PP2C, dephosphorylates [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV]
38.48 kDa
protein length
335 aa Sequence Blast
gene length
1008 bp Sequence Blast
control of [protein|search|SigB ]activity
protein serine phosphatase, environmental PP2C

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • Gene

    521,019 522,026

    The protein

    Catalyzed reaction/ biological activity

  • O-phospho-L(or D)-serine + H2O --> L(or D)-serine + phosphate (according to UniProt)
  • [SW|Domains]

  • [SW|PPM-type phosphatase domain] (aa 123-333) (according to UniProt)
  • Structure

  • [PDB|2J6Y]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE04700 ([gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTAAAATCCACGTTCTTAC, downstream forward: _UP4_TAACGTCTGTCAGACGAGGG
  • BKK04700 ([gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTAAAATCCACGTTCTTAC, downstream forward: _UP4_TAACGTCTGTCAGACGAGGG
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [ homepage]
  • [SW|Rick Lewis], Newcastle, UK [ homepage]
  • References


  • 20658979
  • Original publications

  • 27977677,10632888,8002610,28461450