SubtiBank SubtiBank
yqbP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbP

similar to phage-related protein
locus
BSU26020
pI
10.54
mw
25.18 kDa
protein length
219 aa Sequence Blast
gene length
660 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,672,054 2,672,713

    The protein

    [SW|Domains]

  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] (aa 159-217) [Pubmed|18430080]
  • Biological materials

    Mutant

  • BKE26020 ([gene|0B7A2B5FBA99C052742EC65AE3C69521142084AF|yqbP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATCCAGAATTCATATA, downstream forward: _UP4_ATACCGCAGTAAGCAGGTGA
  • BKK26020 ([gene|0B7A2B5FBA99C052742EC65AE3C69521142084AF|yqbP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATCCAGAATTCATATA, downstream forward: _UP4_ATACCGCAGTAAGCAGGTGA
  • References

    Reviews

  • 18430080
  • Original publications