SubtiBank SubtiBank
yqbP

yqbP

similar to phage-related protein
locus
BSU_26020
pI
10.54
mw
25.18 kDa
protein length
219 aa Sequence Blast
gene length
660 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,672,054 2,672,713

    The protein

    [SW|Domains]

  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] (aa 159-217) [Pubmed|18430080]
  • [SW|LysM domain] (aa 159-217) (according to UniProt)
  • Biological materials

    Mutant

  • BKE26020 ([gene|0B7A2B5FBA99C052742EC65AE3C69521142084AF|yqbP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATCCAGAATTCATATA, downstream forward: _UP4_ATACCGCAGTAAGCAGGTGA
  • BKK26020 ([gene|0B7A2B5FBA99C052742EC65AE3C69521142084AF|yqbP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATCCAGAATTCATATA, downstream forward: _UP4_ATACCGCAGTAAGCAGGTGA
  • References

    Reviews

  • 18430080